This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.

Detection of ISPa1328 and ISPpu21, Two Novel Insertion Sequences in the OprD Porin and blaIMP-1 Gene Among Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa Isolated From Burn Patients


1 Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
2 Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, IR Iran
*Corresponding author: Hossein Goudarzi, Department of Microbiology, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran. Tel: +98-2123872556, E-mail: hgod500@yahoo.com.
Archives of Trauma Research. 6(1): e36239 , DOI: 10.5812/atr.36239
Article Type: Research Article; Received: Jan 12, 2016; Revised: Aug 1, 2016; Accepted: Aug 21, 2016; epub: Aug 29, 2016; collection: Mar 2017

Abstract


Background: Carbapenemes are a good choice for treatment of infections caused by multidrug resistant Pseudomonads aeruginosa. The emergence of carbapenem resistance has become a major problem in treatment of this organism especially among immunocompromised patients including burn patients.

Objectives: The aim of this study was to investigate carbapenem-resistance mechanisms among burn patients in Tehran, Iran, during 2014 - 2015.

Methods: The antibiotic resistance phenotypic test was accomplished by the Kirby Bauer disk diffusion method. The phenotypic investigation of metallo-beta-lactamase (MBL) producers was evaluated by the combined disk diffusion test (CDDT) method. The prevalence of MBL genes, including blaIMP-1 and blaVIM-1 was evaluated by polymerase chain reaction (PCR) and sequencing methods. Amplification of oprD was performed by PCR and the results of sequencing were aligned with wild-type P. aeruginosa strain PAO1.

Results: A total of 100 P. aeruginosa were investigated, of which, 95 were resistance to imipenem. Out Of 95 imipenem resistant isolates,, 81 (85.2%) were MBL producers. Among all isolates, 13 strains carried the blaIMP-1 gene, whereas all of the strains were negative for the blaVIM-1 gene. Amplification of OprD porin was performed for all 100 P. aeruginosa strains. Two insertion sequences (ISs) including ISPpu21 and ISPa1328 were detected in PCR products of OprD gene, that were larger than expected.

Conclusions: The prevalence of β-lactamase-producing isolates and their isolation from life-threatening infections in burn patients is increasing at an alarming rate worldwide. Also, we have identified two novel IS elements, ISPa1328 and ISPpu21, in P. aeruginosa isolates from hospitals in Tehran, Iran. In most of the isolates, insertional inactivation of oprD by ISPa1328 and ISPpu21 were associated with carbapenem resistance.

Keywords: Pseudomonas aeruginosa; Metallo-Beta-Lactamase; Insertion Sequences

1. Background


Burn patients are at risk of acquiring infection because of their damaged skin and impaired immune system. Pseudomonas aeruginosa is a prevalent cause of nosocomial infections around the world and, as an opportunistic pathogen, causes other infections such as septicemia, pneumonia, endocarditis, urinary tract infection, skin, ear and eye infections, as well as being a leading cause of morbidity and mortality among hospitalized burn patients (1, 2). Due to the intrinsic and acquired resistance mechanisms to various antimicrobial agents, there is a serious challenge for choosing the appropriate antibiotic for treating infections by P. aeruginosa (1). Currently, carbapenems are used for the treatment of antibiotic resistant P. aeruginosa infections by targeting cell wall through binding and inactivating penicillin-binding proteins (PBPs) (3, 4). Unfortunately, the emergence of carbapenem resistance among P. aeruginosa isolates has challenged the success of these antibiotics for therapeutic purposes (3). Carbapenem resistance in P. aeruginosa is associated with mutation in the oprD gene encoding the outer membrane porin (OprD) that leads to repression or inactivation of the oprD. The other mechanism of carbapenem resistance is insertional inactivation of oprD by insertion sequence (IS) elements, which subsequently increases the activity of multidrug efflux pumps such as MexAB-OprM. The two mentioned mechanisms are due to mutations in chromosomal genes. Another known mechanism that may cause resistance are transferable elements which code for carbapenemases, especially IMP and VIM that belong to metallo-β lactamases and are responsible for the emergence of resistance to all β-lactams except for aztreonam (2, 5-7).

2. Objectives


The aim of this study was to investigate the mechanisms of carbapenem resistance in P. aeruginosa isolated from burn patients hospitalized in Shahid Motahari Hospital, Tehran, Iran, during 2014 - 2015.

3. Methods


3.1. Bacterial Identification

From march 2014 to march 2015, 100 nonduplicate nonconsecutive P.aeruginosa strains were isolated from burn patients hospitalized in Shahid Motahari Hospital (Tehran, Iran). Prior to sampling, the wounds were washed with isotonic saline. Samples were placed in Stuart’s media, cultured on the blood agar and Mac-onkey agar (Merck Co) and incubated at 37°C for 24 hours. All isolates were identified by conventional biochemical methods (8) including the catalase test, oxidase test, reaction on Tripple Sugar Iron (TSI) medium, oxidation/fermentation of glucose using the oxidative-fermentative (OF) medium and growth ability at 42°C.


3.2. Antimicrobial Susceptibility Testing

An antimicrobial susceptibility test was performed by the Kirby Bauer disk diffusion method on the Muller Hinton agar based on clinical and laboratory standards institute (CLSI, 2013) guidelines. The antibiotic disks (Mast, UK) used during this study were imipenem (IPM: 10 μg), meropenem (MEM: 10 μg), doripenem (DOR: 10 μg), ceftazidime (CAZ: 30 μg), cefotaxime (CTX: 30μg), amikacin (AK: 30μg), ticarcillin (TIC: 75μg) , piperacillin (PRL: 100 μg), piperacillin/tazobactam (PTZ: 100/10 μg), ciprofloxacin (CIP: 5 μg), cefepime (FEP: 30 μg), aztreonam (ATM: 30 μg), gentamicin(GEN: 10 μg) and colistin (Co: 10 μg). Pseudomonas aeruginosa ATCC 27853 was used as the control strain.


3.3. Minimum Inhibitory Concentration

Strains resistant to imipenem, meropenem, ceftazidime and ciprofloxacin by the disk diffusion test were rechecked by the broth microdilution method according to the guidelines of the CLSI 2013 (CLSI). P. aeruginosa ATCC 27853 was used as the control strain.


3.4. Phenotypic Detection of Metallo-Beta-Lactamase

A combined disk diffusion test (CDDT) was performed for the identification of MBLs by imipenem and meropenem (Mast Group, Merseyside, UK) alone and in combination with EDTA. An inhibition zone diameter difference between the discs and discs + EDTA of ≥ 7 mm was interpreted as positive for the presence of an MBL (9). P. aeruginosa PA53 (ACCESSION: KM359726) was used as the control strain.


3.5. DNA Extraction

DNA was extracted using the DNA extraction kit (GeNet Bio Company, Korea, Cat. No. K-3000) according to the manufacturer’s guidelines.


3.6. Detection of blaIMP-1 and blaVIM-1 Genes by Polymerase Chain Reaction

The blaIMP-1, blaVIM-1 and oprD genes were amplified by PCR, using the primers described in Table 1. Three µL of the extracted DNA (100 ng/µL) was added to a final volume of 25 µL PCR mixture containing 12.5 µL of 2× Master Mix (Sinaclon- Iran, CAT. NO.:PR901638), including 1× PCR buffer, 3mmol/L MgCl2, 0.4mmol/L dNTP, and 0.08 IU Taq DNA polymerase,1 µL of 10 pmol/L from each primer and 7.5 µL of sterile distilled water.


Table 1.
Primers Used for Polymerase Chain Reaction and Sequencing

The amplification program was set at 36 cycles of denaturation at 94°C for 45 seconds, annealing at 47°C to 54°C, according to the primers (Table 1), for 45 seconds and elongation at 72°C for 45 seconds. The amplified products were visualized after electrophoresis in 1% agarose gels at 95 V for 45 minutes in 1X TBE containing ethidium bromide under UV irradiation. P. aeruginosa PA53 (ACCESSION: KM359726) for IMP-1, P.aeruginosa Psa1 (ACCESSION: KT313641) for VIM-1 gene and P.aeruginosa PAO1 for oprD gene were used as the control strains.


3.7. Sequencing

The PCR purification kit (Bioneer Co., Korea) was used to purify PCR products. Purified PCR products were used as templates and sent for sequencing analysis at Bioneer Company, Korea. Sequencing of both strands of the oprD PCR products necessitated two additional internal primers including oprDF2 and oprDR2 (Table 1). The nucleotide sequences were analyzed with the Chromas 1.45 software and BLAST in NCBI.


3.8. Statistical Analysis

The statistical analysis was performed with MINITAB16.

4. Results


A total of 100 P. aeruginosa strains were isolated from burn patients. Twenty-six strains (26%) were isolated from females and 74 (74%) from males.The average age of patients was from 2 to 72 years. (distribution shown in Figure 1).


Figure 1.
The Distributions of Age in Burn Patients

The resistance rate of the 100 P. aeruginosa isolates according to the Kirby-Bauer method was as follows: 95 (95%) to imipenem, 95 (95%) to meropenem, 94 (94%) to doripenem, 75 (75%) to ceftazidime, 93 (93%) to cefepime, 94 (94%) to ciprofloxacin, 91 (91%) to amikacin, 90 (90%) to aztreonam, 98 (98%) to ticarcillin, 90 (90%) to piperacillin, 82 (82%) to piperacillin/tazobactam, 95 (95%) to gentamicin and 0 (0%) to colistin.


The results of the MIC test for imipenem, meropenem, ceftazidime and ciprofloxacin on P. aeruginosa isolates are shown in Table 2.


Table 2.
The Result of MIC Test for Imipenem, Meropenem, Ceftazidime and Ciprofloxacin on P. aeruginosa Isolates

Using the combination disk diffusion test method, it was found that among 95 imipenem nonsusceptible P.aeruginosa strains 81 (%85.2) were MBL producers (Figure 2).


Figure 2.
Combined Disk Test Using Imipenem and Imipenem + EDTA. Imipenem + EDTA Disk (on the Left) Produced ≥ 7 mm Larger Zone of Inhibition Than the Imipenem Disk (on the Right)

The prevalence of the blaIMP-1 gene among MBL-producing P. aeruginosa isolates was 13 of 81 (16.04%), while the blaVIM-1 gene was not detected (Figure 3). The nucleotide sequences data reported in this paper have been submitted to the GenBank sequence database and assigned the accession number KT313640 for the blaIMP-1 gene.


Figure 3.
PCR Products of blaIMP-1 Producing Strains of P. aeruginosa Isolates

Amplification of the oprD porin was performed for all 100 P. aeruginosa isolates. Surprisingly, 22 isolates had larger PCR products than expected. The oprD gene was not detected in 9 isolates. Sequencing results and alignment of PCR products of oprD compared with Pseudomonas aeruginosa PAO1 revealed that these large inserts corresponded to ISPpu21 (accession number: KT728193) and ISPa1328 (accession number:KT736319) (Figures 4 and 5).


Figure 4.
Sequence of the ISPpu21 Located in the oprD Gene

Figure 5.
Sequence of the ISPa1328 Located in the oprD Gene

The nucleotide sequence data reported in this study were submitted to the GenBank sequence database and assigned under the accession number KT313640 for the blaIMP-1 gene.

5. Discussion


Pseudomonas aeruginosa is one of the most prevalent causes of nosocomial infections and its resistance to to antibiotics is increasing among strains isolated from burn patients (10, 11). According to the epidemiological research, which has been accomplished around the world, the prevalence of drug resistance especially MBL-coding genes among P. aeruginosa strains has been increased among different countries, regions and even hospitals which are located in various geographical regions. Due to the clinical significance of MBL- producing organisms, isolation of such strains from a patient should be carefully managed (12). The results of this study showed that among all antibiotics, the highest resistance rate was for the following antibiotics: 98% to ticarcillin, 95% to imipenem, meropenem, gentamicin and 94% to doripenem and ciprofloxacin. All the isolates were susceptible to colistin. So, in our study colistin was the most effective antibiotic for treatment of P. aeruginosa infections. Two previous studies conducted by Fallah et al. (10) and Shahcheraghi et al. (13) are similar to our study, which showed resistance against various antibiotics such as beta-lactams (including the 3rd generation of cephalosporins and carbapenemas), aminoglycosides and fluoroquinolons. Saffari et al. reported the imipenem resistance rate of 58.7% among P. aeruginosa isolates in Ahwaz, which was lower than what we have found in our study (14). However, Radan et al. study, in Isfahan, was in agreement with our results: 96% of P. aeruginosa strains which were isolated from hospitalized patients at the burn unit showed resistance to imipenem. Another report, in contrast with our study, found a resistance rate of 21% to imipenem among P. aeruginosa isolates from burn patients in Kurdistan (15). Different studies showed increased resistance of P. aeruginosa to different antibiotics that are caused by indiscriminate and inappropriate use of antibiotics. This antibiotic resistance can be controlled by appropriate antibiotic prescriptions, including low-resistance-potential antibiotics (14). Production of MBLs is one of the carbapenem resistance mechanisms among P. aeruginosa strains (15). In the current study, 85.2% of the isolates were positive for MBL production, which was higher than other studies conducted by Fallah et al. with 58.2% and Hakemi et al. with 17.3% MBL producer isolates (9, 16). In Kurdistan and Ahwaz, 22% and 19.5% of P. aeruginosa strains isolated from burn patients were identified as MBL-producing isolates (14). Another study performed by Sadrei et al. indicated a higher incidence of MBLs than our study (17). All phenotypic results were rechecked by molecular methods. According to the PCR results among MBL producing isolates, 13 (16.04%) isolates were positive for the blaIMP-1 gene; however, the presence of this gene has been previously proved to be variable in different regions and the blaVIM-1 gene has not been detected in P. aeruginosa. The result of blaVIM-1 in this study is similar to those of two other studies from Iran that were individually performed by Fallah et al. (9) and Hakemi et al. in 2012 (16) and the incidence of blaIMP-1 in the mentioned studies was lower than ours and also are in contrast to those of two other studies from Iran: in Tehran 11.43% of the isolated P.aeruginosa strains and in Ahwaz 19.51% of P.aeruginosa isolates were reported to have the blaVIM gene (16). Also, Saderi et al. reported that 94% of P.aeruginosa isolates from Tehran were identified as MBL producers and carried the blaVIM-2 gene (17). In another study Ghamgosha et al. detected blaVIM-1 gene, while none of them were positive for the blaIMP-1 gene (18). Also, Radan et al. reported that all of the imipenem-resistant P. aeruginosa isolates were MBL-positive, and 107 out of 144 (74.3%) of the MBL isolates were positive for the blaIMP gene (15). So, these data are in contrast to ours and this may be related to differences in the time of the studies and consequently to changes in antibiotics prescriptions and antibiotic resistance patterns. These results indicated, participation of other factors such as other MBL- encoding genes, lack of oprD (which results in membrane permeability change), the over expression of efflux pumps or chromosomal AmpC beta-lactamase. In the current study, amplification of oprD showed the presence of the larger fragments of the oprD gene in some isolates, which were associated with ISPpu21 and ISPa1328 insertion sequences. In Al-Bayssari et al. (20) study, ISPa1328 and in Estepa et al. study ISPpu21 insertion sequence was detected in the oprD gene, which was in accordance with our study (19, 20). Earlier studies conducted by Diene et al. in 2013 have demonstrated the oprD gene disrupted by ISpa46 insertion sequences (21). Other IS elements disrupting the oprD gene have been detected in different regions such as Spain (ISPa133) and the United States (ISPa8) (12, 22). These results demonstrate that insertional inactivation of oprD can cause carbapenem resistance among P.aeruginosa strains (22). In spite of many unclear reasons about various studies, this discrepancy may be related to differences in time of the studies, geographical regions, kind of infections, antibiotic therapy regimens or the kinds of primers, which have been used in the study.


5.1. Conclusion

The prevalence of β-lactamase-producing isolates and their isolation from life-threatening infections is increasing at an alarming rate worldwide. Intense pressure for the use of antimicrobial drugs in patients, results in eradication of normal flora and may be a situation of MDR isolates substitution. It was shown in this study that β-lactamase producing P.aeruginosa strains are an emerging threat and should be supervised by implementation of timely identification and strict isolation methods that will help to reduce their severe outcomes and mortality rate in these patients. Also, we have identified two novel IS elements, ISPa1328 and ISPpu21, in P. aeruginosa isolates from hospitals in Tehran, Iran. In most of the isolates, insertional inactivation of oprD by ISPa1328 and ISPpu21 was associated with carbapenem resistance.

Acknowledgments

The present study was financially supported by research department of the school of medicine, Shahid Beheshti University of Medical Sciences (grant No 13202).

References


  • 1. Strateva T, Yordanov D. Pseudomonas aeruginosa - a phenomenon of bacterial resistance. J Med Microbiol. 2009;58(Pt 9):1133-48. [DOI] [PubMed]
  • 2. Gholipourmalekabadi M, Bandehpour M, Mozafari M, Hashemi A, Ghanbarian H, Sameni M, et al. Decellularized human amniotic membrane: more is needed for an efficient dressing for protection of burns against antibiotic-resistant bacteria isolated from burn patients. Burns. 2015;41(7):1488-97. [DOI] [PubMed]
  • 3. Rodriguez-Martinez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2009;53(11):4783-8. [DOI] [PubMed]
  • 4. Meletis G, Exindari M, Vavatsi N, Sofianou D, Diza E. Mechanisms responsible for the emergence of carbapenem resistance in Pseudomonas aeruginosa. Hippokratia. 2012;16(4):303-7. [PubMed]
  • 5. Anvarinejad M, Japoni A, Rafaatpour N, Mardaneh J, Abbasi P, Amin Shahidi M, et al. Burn Patients Infected With Metallo-Beta-Lactamase-Producing Pseudomonas aeruginosa: Multidrug-Resistant Strains. Arch Trauma Res. 2014;3(2):18182. [DOI] [PubMed]
  • 6. Goudarzi H, Taherpour A, Fallah F, Pourkaveh B, Erfanimanesh S, Hashemi A. Laboratory detection of carbapenemases in gram-negative bacteria. Arch Clin Infect Dis. 2016;(In Press)
  • 7. Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother. 2006;50(5):1633-41. [DOI] [PubMed]
  • 8. Pat R, Murray RP, Baron EJ, Jorgensen J, Landry ML. Manual of clinical microbiology. 9 ed. Washington, DC: ASM; 2007.
  • 9. Fallah F, Borhan RS, Hashemi A. Detection of bla(IMP) and bla(VIM) metallo-beta-lactamases genes among Pseudomonas aeruginosa strains. Int J Burns Trauma. 2013;3(2):122-4. [PubMed]
  • 10. Church D, Elsayed S, Reid O, Winston B, Lindsay R. Burn wound infections. Clin Microbiol Rev. 2006;19(2):403-34. [DOI] [PubMed]
  • 11. Rossolini GM, Mantengoli E. Treatment and control of severe infections caused by multiresistant Pseudomonas aeruginosa. Clin Microbiol Infect. 2005;11 Suppl 4:17-32. [DOI] [PubMed]
  • 12. Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005;18(2):306-25. [DOI] [PubMed]
  • 13. Shahcheraghi F, Nikbin VS, Feizabadi MM. Identification and genetic characterization of metallo-beta-lactamase-producing strains of Pseudomonas aeruginosa in Tehran, Iran. New Microbiol. 2010;33(3):243-8. [PubMed]
  • 14. Saffari M, Firoozeh F, Pourbabaee M, Zibaei M. Evaluation of metallo-β-lactamase-production and carriage of bla-vim genes in pseudomonas aeruginosa isolated from burn wound infections in Isfahan. Arch Trauma Res. 2016;Inpress
  • 15. Radan M, Moniri R, Khorshidi A, Gilasi H, Norouzi Z, Beigi F. Emerging Carbapenem-Resistant Pseudomonas aeruginosa Isolates Carrying bla IMP Among Burn Patients in Isfahan, Iran. Arch Trauma Res. 2016;Inpress
  • 16. Hakemi Vala M, Hallajzadeh M, Hashemi A, Goudarzi H, Tarhani M, Sattarzadeh Tabrizi M, et al. Detection of Ambler class A, B and D ss-lactamases among Pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014;27(1):8-13. [PubMed]
  • 17. Saderi H, Lotfalipour H, Owlia P, Salimi H. Detection of metallo-β-lactamase producing pseudomonas aeruginosa isolated from burn patients in Tehran, Iran. Labmedicine. 2010;41:609-12.
  • 18. Ghamgosha M, Shahrekizahedani S, Kafilzadeh F, Bameri Z, Taheri RA, Farnoosh G. Metallo-beta-Lactamase VIM-1, SPM-1, and IMP-1 Genes Among Clinical Pseudomonas aeruginosa Species Isolated in Zahedan, Iran. Jundishapur J Microbiol. 2015;8(4):17489. [DOI] [PubMed]
  • 19. Al-Bayssari C, Valentini C, Gomez C, Reynaud-Gaubert M, Rolain JM. First detection of insertion sequence element ISPa1328 in the oprD porin gene of an imipenem-resistant Pseudomonas aeruginosa isolate from an idiopathic pulmonary fibrosis patient in Marseille, France. New Microbes New Infect. 2015;7:26-7. [DOI] [PubMed]
  • 20. Rojo-Bezares B, Estepa V, Cebollada R, de Toro M, Somalo S, Seral C, et al. Carbapenem-resistant Pseudomonas aeruginosa strains from a Spanish hospital: characterization of metallo-beta-lactamases, porin OprD and integrons. Int J Med Microbiol. 2014;304(3-4):405-14. [DOI] [PubMed]
  • 21. Diene SM, L'Homme T, Bellulo S, Stremler N, Dubus JC, Mely L, et al. ISPa46, a novel insertion sequence in the oprD porin gene of an imipenem-resistant Pseudomonas aeruginosa isolate from a cystic fibrosis patient in Marseille, France. Int J Antimicrob Agents. 2013;42(3):268-71. [DOI] [PubMed]
  • 22. Wolter DJ, Acquazzino D, Goering RV, Sammut P, Khalaf N, Hanson ND. Emergence of carbapenem resistance in Pseudomonas aeruginosa isolates from a patient with cystic fibrosis in the absence of carbapenem therapy. Clin Infect Dis. 2008;46(12):137-41. [DOI] [PubMed]

Table 1.

Primers Used for Polymerase Chain Reaction and Sequencing

Target Gene Sequence of Primers (5 to 3 ) Product Size (bp) Annealing Temperature
VIM1-F GATGGTGTTTGGTCGCATA 390 54°C
VIM1-R CGAATGCGCAGCACCAG
IMP1-F GAAGGCGTTTATGTTCATAC 587 47°C
IMP1-R GTAAGTTTCAAGAGTGATGC
OprDF1 ATGAAAGTGATGAAGTGGAG 1329 50°C
OprDR1 CAGGATCGACAGCGGATAGT
OprDF2 AACCTCAGCGCCTCCCT Primers for Sequencing
OprDR2 AGGGAGGCGCTGAGGAT

Table 2.

The Result of MIC Test for Imipenem, Meropenem, Ceftazidime and Ciprofloxacin on P. aeruginosa Isolates

Antibiotics MIC(µg/mL)
Resistance Intermediate Sensitive
Imipenem 90 (90%) 5 (5%) 5 (5%)
Meropenem 90 (90%) 5 (5%) 5 (5%)
Ceftazidime 72 (72%) 3 (3%) 25 (25%)
Ciprofloxacin 96 (96%) 1 (1%) 3 (3%)

Figure 1.

The Distributions of Age in Burn Patients

Figure 2.

Combined Disk Test Using Imipenem and Imipenem + EDTA. Imipenem + EDTA Disk (on the Left) Produced ≥ 7 mm Larger Zone of Inhibition Than the Imipenem Disk (on the Right)

Figure 3.

PCR Products of blaIMP-1 Producing Strains of P. aeruginosa Isolates
N: control negative, P: control positive, 1,2 positive isolates

Figure 4.

Sequence of the ISPpu21 Located in the oprD Gene

Figure 5.

Sequence of the ISPa1328 Located in the oprD Gene